KIAA1797

KIAA1797 is a protein that in humans is encoded by the KIAA1797 gene.[5]

FOCAD
Identifiers
Aliases	FOCAD, KIAA1797, focadhesin
External IDs	OMIM: 614606 MGI: 2676921 HomoloGene: 9842 GeneCards: FOCAD
Gene location (Human) Chr. Chromosome 9 (human)[1] Band 9p21.3 Start 20,658,309 bp[1] End 20,995,955 bp[1]
Gene location (Mouse) Chr. Chromosome 4 (mouse)[2] Band 4|4 C4 Start 88,094,629 bp[2] End 88,411,011 bp[2]
Orthologs
Species	Human	Mouse
Entrez	54914	230393
Ensembl	ENSG00000188352	ENSMUSG00000038368
UniProt	Q5VW36	A2AKG8
RefSeq (mRNA)	NM_017794 NM_001375567 NM_001375568 NM_001375570	NM_001081184
RefSeq (protein)	NP_060264 NP_001362496 NP_001362497 NP_001362499	NP_001074653
Location (UCSC)	Chr 9: 20.66 – 21 Mb	Chr 4: 88.09 – 88.41 Mb
PubMed search	[3]	[4]
Wikidata
View/Edit Human View/Edit Mouse

A specific single-nucleotide polymorphism rs7875153 in KIAA1797 is associated with heart rate.[6]

Gene

KIAA1797 is a protein-coding gene in Homo sapiens. Alternate names for the gene are FLJ20375, OTTHUMP00000069845, and hypothetical protein LOC54914.[5] Located on chromosome 9 at area q21.3,[7] the entire gene including introns and exons is 375,010 base pairs on the plus strand. There are 19 alternative splice variants. Longest variant yields a mRNA of 6117 base pairs.

Expression

KIAA1797 was determined to express ubiquitously at varying levels throughout the human body. Based on the EST profile of Unigene, KIAA1797 expression have been observed in tissues ranging from reproductive to secretory.[8]

mRNA

Predicted secondary mRNA structures in the 5'UTR and the 3'UTR are “ugagaugaacucgguaucuca” and “uccuaagagaggag” respectively. Other possible secondary structures are shown in the table below.

Protein sequence

The main isoform of the human protein is 1801 amino acid long, a total of 200,072 Da.[7]

Two distinct Domain of unknown function(DUF) are found in the sequence.DUF3730 (465-682aa) appears two times in the sequence; this domain family is found in eukaryotes and is typically between 220 and 262 amino acids in length. DUF3028(1213-1801aa). No additional information was provided regarding this DUF.

Homology

KIAA1797 is well conserved in mammals. However, it is also found in non-mammalians with lower sequence identities.

Ort of kiaa1797 pic

Gene Neighborhood

KIAA1797 is downstream of MLLT3 and upstream of PTPLAD2. MLLT3 is involved with myeloid/lymphoid or mixed-lineage leukemia. PTPLAD2 is a protein tyrosine phosphatase.

Function

The exact function of KIAA1797 is not yet understood by the scientific community. It is, however, found to be a transmembrane proteins.

References

1. GRCh38: Ensembl release 89: ENSG00000188352 - Ensembl, May 2017
2. GRCm38: Ensembl release 89: ENSMUSG00000038368 - Ensembl, May 2017
3. "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
4. "Mouse PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
5. "Entrez Gene: KIAA1797".
6. Melton PE, Rutherford S, Voruganti VS, Göring HH, Laston S, Haack K, Comuzzie AG, Dyer TD, Johnson MP, Kent JW, Curran JE, Moses EK, Blangero J, Barac A, Lee ET, Best LG, Fabsitz RR, Devereux RB, Okin PM, Bella JN, Broeckel U, Howard BV, MacCluer JW, Cole SA, Almasy L (September 2010). "Bivariate genetic association of KIAA1797 with heart rate in American Indians: the Strong Heart Family Study". Hum. Mol. Genet. 19 (18): 3662–71. doi:10.1093/hmg/ddq274. PMC 2928129. PMID 20601674.
7. AceView NCBI Gene Information AceView Archived April 7, 2006, at WebCite
8. "EST Profile – Hs.283322". National Center for Biotechnology Information, United States National Library of Medicine.

Further reading

• Rose JE, Behm FM, Drgon T, et al. "Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score". Mol. Med. 16 (7–8): 247–53. doi:10.2119/molmed.2009.00159. PMC 2896464. PMID 20379614.
• Chapuis J, Hot D, Hansmannel F, et al. (2009). "Transcriptomic and genetic studies identify IL-33 as a candidate gene for Alzheimer's disease". Mol. Psychiatry. 14 (11): 1004–16. doi:10.1038/mp.2009.10. PMC 2860783. PMID 19204726.
• Maruyama K, Sugano S (1994). "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides". Gene. 138 (1–2): 171–4. doi:10.1016/0378-1119(94)90802-8. PMID 8125298.
• Nagase T, Nakayama M, Nakajima D, et al. (2001). "Prediction of the coding sequences of unidentified human genes. XX. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro". DNA Res. 8 (2): 85–95. doi:10.1093/dnares/8.2.85. PMID 11347906.