33
11
The challenge:
Make a function that finds the longest palindrome inside a string.
Note: This is a code-trolling question. Please do not take the question and/or answers seriously. More information here.
33
11
The challenge:
Make a function that finds the longest palindrome inside a string.
Note: This is a code-trolling question. Please do not take the question and/or answers seriously. More information here.
19
The following solution in Go employs the hidden powers of concurrency, closures and recursivity to find the longest palindrome inside a given string:
func lp(s string) string {
for i, l := 0, len(s); i < l; i++ {
if s[i] != s[l-i-1] {
a, b := make(chan string), make(chan string)
go func() {
a <- lp(s[:l-1])
}()
go func() {
b <- lp(s[1:])
}()
c, d := <-a, <-b
if len(c) > len(d) {
return c
}
return d
}
}
return s
}
Additionally, it relies entirely on language primitives and built-in types – no standard library – that's how you recognize true quality software.
You might want to turn your thread, memory and stack size limits up a bit for larger input strings – this is because this solution is so fast that your OS will get all jealous on it.
Edit – Perks:
"345345ABCDEabcde edcbaDEABC12312123"45
def longest_palindrome(s):
return 'racecar'
Example usage:
>>> print longest_palindrome('I like racecars!')
racecar
Note: this may only work for certain strings.
21I tried it with "abcdedcba" but it just returned "racecar"... what am I doing wrong? – Joe Z. – 2013-12-28T03:26:25.167
22@JoeZ. You're using the wrong string. Try it with 'abcde racecar'. – grc – 2013-12-28T04:24:14.973
3It seems too obvious though... – None – 2013-12-28T04:28:49.227
10Okay, but now I'm trying it with "abcde racecar edcba" and it still only returns "racecar" even though there's a much bigger palindrome available. – Joe Z. – 2013-12-28T04:57:19.170
63@JoeZ. Hmm... Probably a unicode issue. – grc – 2013-12-28T06:18:05.063
11@JoeZ. You should probably buy a new computer. – emory – 2013-12-28T14:35:08.923
1When I compare this with other solutions, it seems to be the fastest one, you must be using the N-X-P algorithm. – Satoru.Logic – 2014-03-13T07:09:29.230
13
Clearly, checking for Palindromes is hard.
So the solution is pretty simple - generate a set of every single possible Palindrome as large as the string you're testing, and see if your string contains it.
C#
string largest = String.Empty;
for(int i=0; i < myString.lenght; i++)
{
//Don't use the newfangled stringbuilder. Strings are awesome
char[] testString = new char[i];
for (int charPosition=0; charPosition < i/2; charPosition++)
{
for (char c = 'A'; c <= 'Z'; c++)
{
if ((charPosition/i) == i/2)
{
//middle one
testString[i] = c;
}
else
{
//do one for that position, and the lenght-position
testString[i] = c;
testString[testString.length - i] = c;
}
if (myString.Contains(testString.ToString())
{
//yaay
largest = testString.ToString();
}
{
}
}
}
}
(I might need to check my code for correctness, but otherwise its a wonderfully horribly inefficient way to check for Palindromes)
They will obviously never run the programs on long strings because they are so hard to compute. So this is fine. You can scale it by running it on a better VPS or in a data center, if you are running it in an enterprise setting. For homework it should be fine with just 3-4 character strings. – Emil Vikström – 2014-01-02T17:54:26.133
12
Does everything asked for. It is actually better, because it takes into account every possible subsequence. What's the catch? It operates in exponential time, so each additional character in the string doubles the running time. Give it more than 20 characters, and it will take all day.
$inputstring = <>;
@arrayofcharacters = split("",$inputstring);
for(0..2**length($inputstring)-1){
$currentsubsequence = "";
@choice=split("",sprintf("%b",$_));
for(0..$#arrayofcharacters){
$currentsubsequence .= "$arrayofcharacters[$_]" x $choice[$_];
if($currentsubsequence eq reverse($currentsubsequence)){
$palindromes{length($currentsubsequence)} = $currentsubsequence;
$palindromes[~~@palindromes] = length($currentsubsequence);
}
}
}
print($palindromes{@{[sort(@palindromes)]}[$#palindromes]})
Input: iybutrvubiuynug. Output: ibutubi.
Input: abcdefghijklmnopqrstuvwxyzzyxwvutsrqponmlkjihgfedcba. Output: won't happen
This is literally my answer, but in Perl. Also, not Monekmized. edit: nvm, mine's more efficient – None – 2013-12-28T03:43:24.330
I posted my answer before yours, so it's not copying. – PhiNotPi – 2013-12-28T03:46:08.687
2I had the idea first! I just took longer to write it (had to think up the C and monkey jokes. Also, the optimization is worth the extra development time) – None – 2013-12-28T03:48:15.057
6That's okay. I pride myself in my inefficiency. – PhiNotPi – 2013-12-28T03:49:53.873
10
Your problem is easily solved by regular expressions, just like in the picture below (but I decided to use java instead). This happens because regex is always the best tool that may be used for anything that involves extracting or analyzing text.

package palindrome;
import java.util.regex.Pattern;
import javax.swing.JOptionPane;
public class RegexPalindrome {
private static String next(String now) {
if (now.isEmpty()) return "a";
String prefix = now.length() == 1 ? "" : now.substring(0, now.length() - 1);
if (now.endsWith("z")) return next(prefix) + "a";
return prefix + String.valueOf((char) (now.charAt(now.length() - 1) + 1));
}
public static void main(String[] args) {
String text = JOptionPane.showInputDialog(null, "Type some text:");
String bestPalindromeFound = "";
for (String searchText = "a"; searchText.length() <= (text.length() + 1) / 2; searchText = next(searchText)) {
String reverse = new StringBuilder(searchText).reverse().toString();
if (searchText.length() * 2 - 1 > bestPalindromeFound.length()) {
Pattern p = Pattern.compile(".*" + searchText + reverse.substring(1) + ".*");
if (p.matcher(text).matches()) bestPalindromeFound = searchText + reverse.substring(1);
}
if (searchText.length() * 2 > bestPalindromeFound.length()) {
Pattern p = Pattern.compile(".*" + searchText + reverse + ".*");
if (p.matcher(text).matches()) bestPalindromeFound = searchText + reverse;
}
}
JOptionPane.showMessageDialog(null, "The longest palindrome is \"" + bestPalindromeFound + "\".");
}
}
This code is evil because:
And of course, the GUI parts are only there to distract :> – Emil Vikström – 2014-01-02T17:56:15.840
@EmilVikström Yeah, a side effect of code-trolling is that we can happily subvert the MVC pattern. Further, a lazy OP probably does not knows what MVC is, and would be much more impressed by a program that have all the GUI coupled in it and think that it is more beautiful and advanced than those old prompt/console/DOS-style boring windows (but his teacher might not think so). OTOH, if the lazy OP does not likes the coupled GUI, well, that is nice, the objective was to frustrate him anyway. – Victor Stafusa – 2014-01-02T18:08:53.753
Even the prelude is incorrect. Technically speaking, palindromes are not part the class of Regular Grammars and therefore not recognizable by regular expressions. Luckily we have PCRE which includes come of the class of Context-Sensitive Grammars. – recursion.ninja – 2014-01-02T19:46:51.230
7
This takes the string, and reorganises it to the longest possible palindrome available.
For example:
Input : Hello
Ouput : lol
def get_palindrome(string):
if len(string) == 0:
return "I didn't catch that"
list_of_characters = []
occurances = []
for character in string:
if not character in list_of_characters:
list_of_characters.append(character)
occurances.append(1)
else :
occurances[list_of_characters.index(character)] +=1
#check if a palindrome is possible
if sum(occurances) == len(occurances): #no double letters, so only a one character palindrome
return list_of_characters[0]
first_half = ''
second_half = ''
middle_character = ''
for index, character in enumerate(list_of_characters):
number_of_occurances = occurances[index]/2
first_half += character * number_of_occurances
second_half = (character * number_of_occurances)+ second_half
if (occurances[index]%2 != 0):#if there are an odd number, there will be one spare,
#so put it in the middle
middle_character = character
return first_half + middle_character + second_half
print(get_palindrome(raw_input("String containing palindrome:")))
3That's actually pretty cheeky XD – Sean Allred – 2013-12-28T17:45:20.980
7
Very cool question dude!
Palindromes in normal language are not entirely clearly specified, for example if spaces are allowed or not. So it is not clear if these should be allowed as palindromes or not:
Anyway, I think you are referring to the better specified scientific meaning of palindrome: For a nucleotide sequence to be considered as a palindrome, its complementary strand must read the same in the opposite direction. Both the strands i.e the strand going from 5' to 3' and its complementary strand from 3' to 5' must be complementary (see here).
There is some research done for palindrome sequence recognition and I think you should really read at least this. To solve your problem you can pretty much just copy their approach! The professor even sends out the source code if you ask him.
Well, now to the problem at hand. Suppose you have a nucleotide sequence given as a character string. The best way to find palindromes in such a sequence is by using standard algorithms. I think your best bet is probably using this online tool: http://www.alagu-molbio.net/palin.html
Since you are required to provide a function that does the task, you need to think about how to get your string into this app? Well, there the fun begins. I think you could use selenium for that. Since I don't want to do your homework, i just give you the basic idea. In Java you world start like this:
package testing;
import java.util.regex.Matcher;
import java.util.regex.Pattern;
import org.openqa.selenium.By;
import org.openqa.selenium.WebDriver;
import org.openqa.selenium.WebElement;
import org.openqa.selenium.phantomjs.PhantomJSDriver;
public class PalindromeService {
public static void main(String[] args) {
WebDriver d1 = new PhantomJSDriver();
d1.get("http://www.alagu-molbio.net/palin.html");
String sequence = "AAGTCTCGCGAGATCTCGCGAGATCTCGCGAGATCTCGCGAGAAA";
WebElement txtArea = d1.findElement(By.tagName("textarea"));
txtArea.sendKeys(sequence);
WebElement send = d1.findElement(By.cssSelector("input[type=submit]"));
send.click();
String result = d1.findElement(By.tagName("body")).getText();
Pattern p = Pattern.compile(".*capitalized\\.[^agctACGT]*([agctACGT]+).*");
Matcher m = p.matcher(result);
if (m.find()){
result = m.group(1);
}
//now you have all palindromes in upper case!
//I think you can take it from here, right?
System.out.println(result);
d1.quit();
}
}
In case you are interested in language palindromes you can use the same technique with other web services like http://www.jimsabo.com/palindrome.html or http://calculator.tutorvista.com/math/492/palindrome-checker.html
omit the truely helpful sources like http://rosettacode.org/wiki/Palindrome_detection
interesting but unhelpful blah about bioinformatics
deliberately misunderstanding this as bioinformatics task
cheating - to solve the problem a web service is used
6
def get_substrings(a_string):
"""Get all possible substrings, including single character substrings"""
for start_index in range(len(a_string)):
for end_index in range(start_index + 1, len(a_string) + 1):
yield a_string[start_index:end_index]
def get_longest_palindrome(a_string):
"""Find the longest palindrome in a string and return its index or -1"""
# Initialise variables
longest_palindrome = get_longest_palindrome.__doc__[5:27]
palindromes_list = []
# Search string for all palindromes
for substring in get_substrings(a_string):
if reversed(substring) == substring:
palindromes_list.append(substring)
# There should always be palindromes in non-empty strings (single characters),
# but it's good practice to check anyway
if len(palindromes_list) > 0:
longest_palindrome = max(palindromes_list, key=len)
return a_string.find(longest_palindrome)
The string "the longest palindrome" is extracted from the docstring into longest_palindrome.
The reversed() function returns an iterator, so reversed(substring) == substring will never be true and longest_palindrome will never be overwritten.
Hence, the function will literally find "the longest palindrome" inside a string.
But "the longest palindrome" isn't even a palindrome... and somebody else's already posted this one. – Joe Z. – 2013-12-28T03:21:48.300
4The problem with solutions like these are that they're too obvious. Even a beginner programmer would know you're leading them on. – Joe Z. – 2013-12-28T03:22:12.287
1@JoeZ. I've added a much less obvious version. – grc – 2013-12-28T05:05:29.040
1Your less obvious version hits the mark. It would be nice if you removed the obvious version, though. – Joe Z. – 2013-12-28T05:29:34.173
5
Oh, thats easy ;). Here ya go:
function () {
var palidrome = "Star? Not I! Movie – it too has a star in or a cameo who wore mask – cast are livewires.
Soda-pop straws are sold, as part-encased a hot tin, I saw it in mad dog I met. Is dog rosy? Tie-dye booths in rocks.
All ewes lessen ill. I see sheep in Syria? He, not I, deep in Syria, has done. No one radio drew old one.
Many moths – I fondle his; no lemons are sold. Loot delis, yob, moths in a deli bundle his tin. Pins to net a ball I won – pins burst input. I loot to get a looter a spot paler. Arm a damsel – doom a dam. Not a base camera was in a frost, first on knees on top spot. Now a camera was a widened dam.
Ask: Cold, do we dye? No, hot – push tap, set on to hosepipe. Nuts in a pod liven.
A chasm regrets a motto of a fine veto of wars. Too bad – I all won. A sadist sent cadets – a war reign a hero derides. A bad loser, a seer, tossed a cradle – he begat to cosset – a minaret for Carole, Beryl, Nora. We’re not as poor to self.
I risk cold as main is tidal. As not one to delay burden, I don’t set it on “hot”. A foot made free pie race losses runnier. As draw won pull, eye won nose. Vile hero saw order it was in – even a moron saw it – no, witnessed it: Llama drops – ark riots. Evil P.M. in a sorer opus enacts all laws but worst arose. Grab a nosey llama – nil lesser good, same nicer omen.
In pins? No, it is open. If a top spins, dip in soot.
Madam, as I desire, dictates: Pull aside, damsels, I set a rag not for a state bastion. A test I won e.g. a contest I won.
Kidnap, in part, an idle hero. Megastars, red, rosy, tied no tie. Blast! A hero! We do risk a yeti’s opposition!
He too has a wee bagel still up to here held.
Demigods pack no mask, cap nor a bonnet, for at last a case is open – I left a tip – it wets. A dog wets too. Radios to help pay my tip, pull a tip.
Ale, zoo beer, frets yon animal. Can it? New sex arose but, we sots, not to panic – it’s ale – did I barrel? Did I lose diadem, rare carrot in a jar of mine? Droop as tops sag – unseen knots.
A cat ate straw as buck risk cud; evil foe, nil a red nag ate? Bah! Plan it – silage. Model foot in arboreta.
I, dark Satanist, set fire – voodoo – to slat. I design a metal as parrot, I deem it now. One vast sum is no ten in set – amen! Indeed, nine drag a yam, nine drag a tie. Dame nabs flower; can we help man? Woman is worse nob.
Mud level rose, so refill a rut. A nag of iron I made to trot I defied – I risk leg and its ulnae. Can a pen I felt to bid dollar or recite open a crate, open a cradle, his garret?
Sample hot Edam in a pan. I’m a rotten digger – often garden I plan, I agreed; All agreed? Aye, bore ensign; I’d a veto – I did lose us site. Wool to hem us? No, cotton. Site pen in acacias or petals a last angel bee frets in.
I met a gorilla (simian); a mate got top snug Noel fire-lit role. Manet, Pagnol, both girdle his reed bogs.
Flan I reviled, a vet nods to order it, Bob, and assign it. Totem users go help mates pull as eye meets eye. Son – mine – pots a free pie, yes? No. Left a tip? Order a dish to get. A ring is worn – it is gold. Log no Latin in a monsignor, wet or wise. Many a menu to note carrot.
Cat in a boot loots; As I live, do not tell! A bare pussy, as flat on fire, I know loots guns, fires a baton, nets a hero my ale drop made too lax.
If it is to rain, a man is a sign; I wore macs, no melons rot. I use moths if rats relive, sir, or retire.
Vendor pays: I admire vendee, his pots net roe. Nine dames order an opal fan; I’ll ask cold log fire vendor to log igloo frost. Under Flat Six exist no devils.
Marxist nods to Lenin. To Lenin I say: “Mama is a deb, besides a bad dosser.”
Gen it up to get “ova” for “egg”. I recall a tarot code: yell at a dessert side-dish sale. Yes/nos a task cartel put correlate: E.S.P. rocks a man. I am a man, am no cad, I’m aware where it’s at!
Fire! Its an ogre-god to help, man, as I go. Do not swap; draw, pull a troll!
It’s not a cat I milk – calf, for a fee, sews a button – knit or tie damsel over us. Mined gold lode I fill until red nudes I met in a moor-top bar can. I sit, I fill a diary – trap nine men in ten-part net – oh, sir, I ask, cod nose? No, damp eel.
So, to get a name! I say, Al! I am Al! Last, I felt, to breed, deer begat.
To can I tie tissue – damp – or deliver Omani artist – a man of Islam.
In a den mad dogs lived on minis a signor who lived afore targets in at. As eremites pull, I, we, surf, fantasise, mend a bad eye. No hero met satyr; Tony, as I stressed, won’t, so cosset satyr.
A vet on isles made us sign it, a name. Foe man one sub.
Aside no dell I fret a wallaby; metal ferrets yodel, like so. On a wall I ate rye. Bored? No, was I rapt! One more calf? O.K., calf, one more, bossy! No! Lock cabin, rob yam, sip martini. Megastar was in a risk.
Cat? No, I’m a dog; I’m a sad loyal pet. A design I wore – kilts (a clan); if net drawn, I put it up. Royal spots snag – royal prevents rift.
Composer, good diet, are both super, God – label it a love of art, lustre. Video bored, no wise tale e.g. a mini tale – no sagas seen. Knack: cede no foes a canal.
Pay – as I sign I lie; clear sin it is; e.g. “Amadeus” sign I – lira for ecu, decimal – sin as liar.
Trad artistes pull a doom, a drawer won’t.
Is it sold loot? No, I suffered loss. A man is god; Amen! I came nice Tahiti (sic).
It’s ale for a ban if for a fast – is role to help mash turnip? Use zoo? No – grasp order – use no zoos. Warts on time did sag.
No grade “X” “A” Level? Oh, “A”! I’d a “B” or a “C”. So – pot? No, we lop. Date? Take no date! Bah! Play L.P.
Miss (a lass, all right?) flew to space in NASA era. Rose no (zero) cadets ate raw. As a wise tart I fined rags red Lenin, we help pay bet – a risk – cash to Brian. I put a clam in a pool – a pool wets.
Mahdi puts a stop to harem – miss it in one vote, lost in one, veto of none. Post-op, no tonsil; I ate; no tastier, eh? We sleep at noon time so I dare not at one; no time stops as I time tides. A bed: under it, roll; in a mania, panic!
In a pond I did as Eros as Lee felt tenrec. “Ink” – list it under “I”. Termites put pen in a way. Democrats wonder, I too. To slay moths a dog did.
I saw elf; elf, far now, is a devilish taboo, rag-naked. I hid a bootleg disc. I, saboteur, toss it in. Oops! No legs! Laminated, a cask, conker in it, negates all if it is simple.
Hot pages are in a mag, nor will I peer, familiar tat, so lewd, native rot. Toner, ewe wore no trace; vagabond ewes do. Oh, Ada! Have pity! A pitiable eel – “Oh wet am I!” – to save, note: bite gill as I do.
Call a matador minor, eh? As I live, don’t! Is torero no rigid animal debaser if tipsy? Ale drew esteem in a matador. A bolero, monks I rate play or go dig rocks; a can I step on.
Go! Gas – it evades a bedsit – set a roost on fire. Boss sent a faded eclair to green imp or dog, I’d don a belt to boot it; if Ada hid a boot, panic.
I mock comic in a mask, comedian is a wit if for eventide. Vole no emu loved is not a ferret, so pet or witness a weasel if not. I hired less, am not so bossy, as yet amateur.
To stir evil, Edna can impugn a hotel: bad loos, hot on Elba: I may melt. Tart solicits it rawer, gets it rare. Push crate open; I ram buses, use no trams.
Did I say, not to idiot nor a bare ferret, to trap rat, strap loops rat? Stewpot was on. Hot? I was red! Lessen it! Fine man on pot? No, pen inside by a bad law. So I made rips – nine delays.
Some Roman items in a.m. ordered “Is room for a ban?” “It is,” I voted: I sat pews in aisle. Beryl, no tiro to my burden, made off for a contest, I won kiss. I may raid fine dales. I raid lochs if I to help am.
Forecast for Clare v. Essex: If no rain, a man is ref. Fusspots net foxes.
Senor is a gnome, latinos’ bad eyesore. Help misses run to border, Casanova, now, or drab hotel.
Ma has a heron; I sleep, pet’s on nose, sir! Rev. I rag loved art live – fine poser. Ultra-plan: I feign, I lie: cedar to disperse – last one? No, last six. Enamel bonnet for a dark car to toss a snail at. In it all, Eve lost; Seth’s a hero slain on a trap – Rise, Sir Ogre Tamer.
Upon Siamese box I draw design. I, knight able to help, missed an alp seen in Tangier of fine metal pots. Tin I mined rages – order nine, melt ten. Tone radios; tones are not to concur. Ten-tone radar I bomb – best fire-lit so hostel side meets eerie mini red domicile. A gulf to get is not a rare tale; no time to nod.
Row on, evil yobs, tug, pull. If dogs drowse, fill a rut. An era’s drawers draw. Put in mid-field in a band I dig a tub deep. Staff on a remit did refill a minaret.
Sam’s a name held in a flat, or, sir, bedsit. I wonder, is it illicit ore? No ties? A bit under? Retarded? Is ‘owt amiss? I’m on pot; not so Cecil, a posh guy a hero met. A red date was not to last so Cecil sat.
Tip? An iota to pay, a dot; sad, I drop item. I’d ask, call, Odin, a Norseman’s god: “Pay payee we owe radio dosh o.n.o.” I to me? No, I to media.
Peril in golf – is ball a “fore”? K.O.!
Vexed I am re my raw desires. Alto has eye on nose but tone-muser pianist is level-eyed. I lost a tie. Blast! In uni no grades are musts. Avast! Never port! Sea may be rut.
Part on rose? – It’s a petal. Define metal:
Tin is . (I gulp!) can!
I am a fine posse man, I pull a ton. Ron, a man I put on, I made suffer of evil emu’s sadism. Leo’s never a baron – a bad loss but evil – topple him, Leo’s lad. Assign a pen, can I? A pal is note decoding.
Is damp mule tail-less? No, ill; I breed for its tone. Radio speed, to grower, grew. Open a lot? No, stamp it; if for a free peso – not ecu -deign it. Times ago stone rates, e.g. at Scilly, display a wont.
No wish to get a design I, Sir Des, I’ve let? No bus sees Xmas fir. O.K. – cab – tart it up; tie lots – diamond, log or tinsel; first end errata edit. So “le vin (A.C.)”, Martini, Pils lager, one tonic.
I pegged a ball up to here when I got a top star role, Beryl. Gun is too big – won’t I menace? Yes? No?
Ill? A cold? Abet icecap’s nip. U.S.A. meets E.E.C. inside tacit sale – see! Beg a cotton tie, ma! No trial, so dodo traps exist. Arabs under-admire card label good hood stole.
In rage erupted Etna. Will a rotunda, bare villa, to tyro. Lack car? Non-U! Get a mini! My, my, Ella, more drums per gong; get a frog – nil less. Rod, never ever sneer. Got to?
I disperse last pair of devils (ah!) here today or else order cash to breed emus. Said I: “Are both superlative?” C.I.D. assign it lemon peel still. I wore halo of one bottle from a ref (football) – a tip; so hit last ego slap a mate got.
Late p.m. I saw gnu here (non-a.m.) or an idea got a dog to nod – I made felt to boot.
Fill in a lad? Nay, not all, Edna – lash to buoy. Did you biff one Venus? Not I! “Broth, girl!” ladies ordered – “No, with gin!” – a fine plate, maybe suet; no carton I made rots in it.
Med: a hill, Etna, clears in it. Ali, Emir, to slap in/slam in. All in all I made bad losers sign it – alibi. Set a lap for a level bat.
A bed, sir, eh? To put cat now? Drat! Such an idyll of a dog’s lair! That`s it, open it – a cage! Big nit sent rat! Some day (A.D.) send ewe. No, draw a pot now, do! Of wary rat in a six ton tub.
Edna, ask satyr: “Tel. a.m.?” No, tel. p.m.; Israeli tuner is damp. Use item: “Anna Regina”. No! Dye main room (“salle”) red!
Nice caps for a sea cadet in U.S.A. – Now I, space cadet, am it, sea vessel rep. Pin it on Maria, help Maria fondle her fine hotpot. No! Meet; set up to net, avoid a lesion. Set acid arena: Bruno one, Reg nil. Like it to sign in? Even I am nine-toed! I vote votes.
Oh, can a nose-rut annoy? No, best is Dorset. I know, as liar, to snoop, malign. “I’ll order it to get a bedroom door,” began a miser I fed.
Am I to peer, fan? Is a door by metal? Ere sun-up, drowse, nod, lose magnet. Food? Buns? I’ll ask. Corn? I’ll ask. Corn – I snack. Cats snack (cold rat). Sum for a bag: nil. First, is remit “traps in net”? Yes, on a par. Coots yell over a dam I made. Bared nudist went a foot, I made roots. I tip a canon: “Row, sir, at same tide; man one: row tug.”
Sewer of denim axes a wide tail – a terror recipe to hero made manic. I, to resign? I ? Never!
“OFT I FELT ITS SENSUOUSNESS” – title fit for evening is erotic; I named a more hot epic – error retaliated – I was examined for ewe’s gut, wore no named item.
A star is worn on a cap, it is too red. Am I too fat? Newts I’d under a bed. Am I mad? Are volleys too crap? A nosey tennis part-timer sits rifling a bar of mustard.
Lock cans, stack cans in rocks, all in rocks, all I snub. Do often games, old ones, word-pun use; relate, my brood, as in a free pot I made fires, I manage brood. Moor debate got tired rolling, I lampoon, so trail saw on kites.
Rod sits, ebony on nature, so Nana chose to veto video. Ten in main evening is O.T.T. i.e. killing; Ere noon, urban eradicates noise, lad, I ovate not. Put esteem on top (to hen, if reheld).
No fair ample hair – am not I nipper-less? Eva estimated ace caps I won as united. A Caesar of space, Cinderella’s moor, Niamey Don (a Niger-an name), ties up mad sire, nut! I, Lear, simpleton male, try tasks “A” and “E”
but not “XI”. Sanitary raw food won top award one Wednesday – a demo.
Start nesting, I beg a cat. I? Nepotist? Ah, trials, God! A folly, Dinah, custard won’t act up; other is debatable. Velar: of palate; sibilating is “s”.
Resold: a bed, a mill, an ill animal – snip, also trim. Eilat in Israel can tell I had ‘em. Tin I stored (am I not raconteuse?) by a metal pen. If a night, I wondered, rose, I’d all right orbit on sun, even off.
I buoy, did you? Both Sal and Ella, Tony and Alan (“Ill if too bottle-fed, am I?”) do not. God! A toga! Ed in a Roman one, rehung! Was I, M.P. et al., to get a map? Also get salt? I, hospital lab to offer, am, or felt to be, no fool – a hero.
Will it sleep? No, melting is sad ice. Vital re-push to be raid, I assume. Deer, both sacred roes, Leroy (a doter, eh?) has lived for. I, apt sales rep’s idiot to greens, revere vendors selling or fat egg-nog reps.
Murder O’Malley, my mini mate – gun on rack. Calory total: liver, a bad nut or all I wanted (“et puree garnie”): lots. “Do, oh do, ogle bald racer,” I’m dared – N.U.S. bar at six.
Esparto, dodo’s lair to name it, not to cage bees, elasticated, is nice. Esteem, as up in space, cite bad local lions, eye can emit now. G.I. boots in ugly rebel or rat’s potato gin (eh?) were hot. Pull a bad egg – epic, I note, no regal slip in it. Ram can . (I’ve lost idea!)
Tarred nets, rifles, nitro, gold – no maid stole it. Put it, rat, back or if Sam (“X”) sees sub on televised rising, I sedate Goths. I won’t – no way.
Alps, idyllic stage set, are not so gas-emitting, I educe. To nose, peer, far off, I tip mats onto lane. Power grew or got deep so I dare not stir. Of deer, billions sell. I ate lump – mad sign, I do cede – tonsil a pain, acne pang is sad also. Elm I help pot, live – tub’s sold; a ban or a bar, even so, elms, I’d assume, live for. Effused am I not, up in a manor, not all up in a mess.
Open if a main A.C. plug is in it.
Late men I fed late – pasties or not. “Rapture” by a maestro prevents a vast sum erased.
Argon in units, albeit at solid eye level, sits in a . (I presume not) . tube, son. No eyes: a hot laser – is Ed wary?
Mermaid, ex- evoker of all A.B.s, I flog. Nil I repaid. Emotion! Emotion, oh so do I dare, woe!
Wee yap-yap dog’s name’s Ron. An idol lacks a dime tip, or did, as today a potato in a pitta slice costs a lot – tons. A wet adder ate more hay. Ugh! So, pal, ice cost on top? No, miss, I’m a two-sided rat, erred nut, I base it on erotic ill; It is I, red now; it is debris, rot.
Alf, an idle he-man as “master animal lifer” did time, ran off at speed, but a G.I. did nab an idle if dim nit. Upwards rewards are natural life’s words, God. Fill up guts, boy, live now or do not emit one later. A rat on site got flu.
Gaelic, I’m odd Erin, I’m Eire, esteemed islet. So hostile rifts ebb. Mob, I.R.A., dare not net R.U.C. – no cotton. Erase not, so I dare not nettle men in red rose garden – I’m in it.
Stop late men if foreign at nine. Esplanades, simple hotel, bath, gin – king is Edward IX; obese; Ma is no pure mater. Go! Rise, sir; part anon.
I also rehash tests – ‘O’ Level Latin, Italian. S.A.S., so, to track radar. Often nobleman exists alone – not sales reps – I do. Trade ceiling, i.e. final part, lures open if evil trade.
Volga River rises on no steppe. Elsinore has a hamlet – Oh, Bard, row on Avon!
A sacred robot nurses simple hero’s eye; dabs on it a lemon. Gas, iron, Essex often stops, suffers in a mania. Ron fixes several crofts, acer of maple. Hot, I fish; cold, I arise laden; if diary amiss, I know it set no car off. Foe-damned ruby motor, it only rebels.
Ian I swept aside to visit, in a bar of moorside red, Romanis met in a more mossy ale den. Inspired am I, Oswald. A bay bed is nine p on top. No name, niftiness- elder saw it. Oh no! Saw top wet star’s pool – part star, part otter. Refer a baron to idiot, Tony, as I did.
Smart ones use submarine.
Poet, arch-super-artiste, grew artistic. I lost rattle; my amiable, not oh so old, able to hang up, mina, can deliver it, so true. “Ta, matey!” – says so Boston (Mass.) elder I hit.
On file S.A.E. was sent – I wrote poster re fat on side, volume one – loved it, never off it, I was in. Aide mocks a manic; I mock comic, I nap: too bad I had a fit, I too. Bottle ban odd, I go drop mine, ergo trial ceded a fatness, sober if not so, or a test is debased.
A vet is agog – no pet’s in a cask – corgi dog, royal pet, a risk no more.
Lob a rod at a man I meet. Sewer delays pit fires – a bedlam in a dig – iron ore rots it. No devil is a hero – Nimrod.
At a mall a cod is all I get. I bet on Eva, so Tim ate whole eel bait, I pay tip, Eva had a hood sewed. No B.A. gave car to Nero, we were not to rev it and we lost a trail; I’m a free pill, I wrong a man. I erase gap; to help miss it, I fill a set. A gent in ire knocks a cadet.
Animals’ gel on spoon – it is so true to basics – I’d gel; too bad I hide kangaroo baths – I lived as I won raffle, flew as I did go, dash, to my, also too tired now, star comedy: A wan, inept, upset I’m retired, nut; its ilk, nicer. Nettle feels a sore; sad, I did no panic in a pain, am an ill or tired, nude, based item; it is a spot.
Semitone, not a tone, radios emit; no, on tape; elsewhere it’s a tone.
Tail is not on; pots open on foot, even on it, so let oven (on, it is) simmer – a hotpot’s a stupid ham stew.
Loop a loop, animal – cat up in air.
Both sacks I rate by apple hewn in elder’s garden if it rates, I was aware – tasted a core.
Zones or areas, Annie, cap, so twelfth girl, lass, alas, simply (alpha beta) done, Kate. Tadpole won top Oscar, Obadiah, “O” Level axed.
Argon gas did emit no straw, so ozone sure drops argon, oozes up in Ruth’s ample hotel or sits afar off in a bar – of elastic, is it?
I hate cinema; cinema dogs in a mass. Older effusion to old – lost, is it now? Reward: a mood.
All upsets it.
Radar trails an Islamic educer of a riling issue, damages it in Israel. Ceiling is, I say, a plan, a case of one deck. Can knees sag as one Latin image elates, I wonder?
Oboe diverts ultra foe, volatile bald ogre – push to berate; I’d do, ogre. So, p.m., Oct. first, never play organ’s stops – lay or put it up in ward ten.
Final cast like rowing – I sedate play, old as am I, God! Am I! On tacks I ran; I saw rats. A Gemini tramp is May born.
I back colony’s sober omen of lack of lace. Rome, not Paris, a wonder.
Obey retail law – a noose killed oyster. Reflate my ball, a water-filled one. Disabuse no name of emanating issue.
Damsels, I note, vary tastes so cost now desserts. I say no! Try taste more honeyed. A bad nemesis at naff ruse will upset. I, mere Satanist, e.g. rater of a devil – (Oh wrong is a sin!) – I’m no devil’s god, damned.
Animals, if on a mat, sit. Rain, a more vile drop, made us site it in a cottage. Breed deer – bottle fits a llama.
I lay, as I emanate, go to sleep, mad ones on docks – air is hot. Entrap, net, nine men in party raid – all if it is in a crab-pot room, an itemised, under-lit, nullified old log den – I’m sure voles made it rot in knot.
Tubas we see far off lack limit. A cat on still or tall upward paws to no dog is an ample hot-dog, ergo nastier if tastier, eh? We, raw amid a conman, a mama in a mask, corpse et al., err.
Octuple tracks at a son’s eyelash side distressed a tall eye doctor, a tall ace, rigger of a vote: got put in egress; odd, abased, is ebbed, as I am, Amy, asinine lot! Nine lots! Don’t six rams live? Don’t six exist?
Alfred, nuts or fool gigolo, trod never if gold locks all in a flap on a red rose; made nine or ten stops.
I heed never, I’m Daisy, a prod never, I terrorise viler starfish. To me suitors, no lemons, came rowing. Is a sin a mania? Rot!
Sit! I fix a looted amp or delay more, hasten not. A baser if snug stool, wonkier, if not – Alf says – super, a ballet to no devil, is a stool too. Ban it, actor, race to no tune.
May names I wrote wrong (Is no man in it, a long old log?) sit in row, sign irate Goths; I dare drop it. At felon’s eye I peer, fast open – I’m nosey, esteem eyes. All upset, ample hogs resume totting. Is sad nabob tired? Roots don’t evade liver in Alf’s gob.
Deers I held right; oblong, apt enamel or tile rifle on gun spot to get a man – aim is all. I rogate, minister. Feeble gnats, alas late, prosaic, a canine pet is not to consume hot.
Loo, wet, issues old idiot; evading, I sneer, obey a deer, gall a deer, gain alpine dragnet for egg I’d net to ram in a pan I made to help master. Rags I held, arcane poet, arcane poetic error, all odd; I bottle fine panacean lust. I’d nag elks I ride if editor toted a minor. I fog a natural life.
Roses, or level dumb ones – rows in a mown, ample, hewn acre. Wolfsbane made it a garden in May, a garden indeed.
Nine mates, nine tons I must save now on time – editor raps a late man. G.I.s edit also, too. Do over if tests in a task radiate. Rob ran; I, too, fled.
“Omega” – list in alphabet.
A gander, a line of live ducks, irk cubs. A wart, set at a cast on knee, snug as spots.
A poor denim for a janitor, racer, armed aide, solid idler – rabid; I’d elastic in a pot, tons to sew.
Tubes or axes went in a clam, in an oyster. Free booze – lap it all up. Pity, my apple hot, so I’d a root stew. God, a stew! Tip it at feline! Posies, a cat’s altar often, no baron packs. A monk caps dog – I meddle here – hot? Pull its leg! A bee was a hoot, eh?
No, it is opposite. Yaks I rode wore hats, albeit on deity’s orders. Rats age more held in a trap, nip and I know it – set no cage now.
It’s eta; no, it’s a beta – Tsar of Tonga rates isles. Mad Ed is all upset at cider, is Ed? Is a madam too? Snip? I’d snip, spot a fine position, snip nine more cinemas.
Do ogres sell in a mall? Yes, on a barge so rats row tubs.
Wall last canes up or Eros, an imp, lives to irk, rasp or dam all tides sent. I won’t – I was no Roman – even I saw tired row – a sore. He lives on. “No!” we yell.
Up, now! Wards are in nurses’ sole care. I, peer, fed, am too fat? Oh, not I, test no dined ruby ale; dote not on salad it’s in – I am sad.
Locks I rifle so troops atone re war. Only rebel or a crofter animates so cottage beheld arcades, so trees are sold, abased. I redo, rehang, I err – a wasted act; nests I’d – as an owl – laid. A boot’s raw foot, even if a foot to master, germs (ah!) can evil do.
Pan is tune-pipe – so hot notes, paths up to honeydew.
Odd locks, a maddened (I was aware) macaw on top, spot no seen knots, rifts or fan, I saw. Are maces a baton, madam? Oodles, madam? Rare laptops are too late – got too lit up.
Nits rub – snip now, I’ll abate, not snip, nits I held.
Nubile Danish tomboys I led to old loser as no melons I held; no fish to my name. Nod lower, do I dare? No, one nods a hairy snipe. (Edit: one hairy snipe, eh?) See silliness, else we’ll ask cornish to obey deity’s or god’s item. I, God, damn it! I was in it! To Hades, acne trap, sad loser! As warts pop, a dosser I – we – vile rat, sack! Same row, oh woe! Macaroni, rats, as a hoot, tie. I vomit on rats.";
return '$system> KERNEL ERROR (DOES. NOT. EXCIST)'
}
:)
1@JoeZ. It actually does ;) Mine has a word count of 24,122! – C1D – 2013-12-28T16:51:17.907
2Awesome! Sir, you win 2 internets and 5 metal ferrets who yodel :) – aditsu quit because SE is EVIL – 2013-12-30T17:10:51.110
4
I find the best way to do this is through the well known Monkey Algorithm, you can probably find it in BOOST. They always had ways of making you talk...
def palindrome?(in)#IMPORTANT
if in.reverse == in
return true
else
return false
end
def getMonkeys(in)#don't forget to interface with C in case of
MaxMonkeys = 0
MonkeyTalk = ""
MonkeySpeed = in.length
(0..MonkeySpeed).each do |monkeyA|
(monkeyA..MonkeySpeed).each do |monkeyB|#optimized!
if palindrome?(in[monkeyA..monkeyB]) do
if in[monkeyA..monkeyB].length > MaxMonkeys do
MonkeyTalk = in[monkeyA..monkeyB]
end
end
end
end
MonkeyTalk
end
This is extremely inefficient, but rather cute and ruby-like if you rename everything to their original names: MaxMonkeys = len; MonkeyTalk = result, MonkeySpeed = strlen; monkeyA : a; monkeyB : b; getMonkeys: getMaxPalindrome.
This is of no value to the OP and risks him deciding to actually interface with C, and we all know how that ends...
4
I refuse to use the standard functions, as they are inefficient. Everyone knows that the best way to look up a length is to have a table to reference, so I create a table of all of the possible palindromes, and sort them using a pythonic bogosort, but in order to improve efficiency, I remove duplicates first. At that point, I compute all of the items which are palindromes, and sort them by lengths. You can then simply take the last length in the list, which has an O(n) lookup by iterating the list.
from itertools import chain, combinations
from random import *
stringToTest = "abba"
#Don't forget to reference code taken from stackoverflow. (http://stackoverflow.com/questions/464864/python-code-to-pick-out-all-possible-combinations-from-a-list)
def FindAllSubsetsOfAString(StringToFindASubsetOf):
return chain(*map(lambda x: combinations(StringToFindASubsetOf, x), range(0, len(StringToFindASubsetOf)+1)))
listOfPermutations = []
#get the length of the string we are testing, as the python function is not portable across platforms
lengthOfStringToCheck = 0
for currentCharacterInString in stringToTest:
lengthOfStringToCheck = lengthOfStringToCheck + 1
lengthOfStringToCheckMinusOne = lengthOfStringToCheck - 1
#Always iterate backwards, it is more efficient for cache hits and misses
for stringBeginningIndex in range(lengthOfStringToCheck, 0, -1):
listOfPermutations.append(stringToTest[stringBeginningIndex:lengthOfStringToCheckMinusOne])
#To save from errors, we must not operate directly on the list we have, that would be inefficient. We must copy the original list manually.
# The built in functions again aren't portable, so we must do this manually, with a deep copy.
OtherListOfPermutations = []
for CurrentItemInOriginalList in listOfPermutations:
TemporaryListItem = []
for CurrentIndexInCurrentItemInOriginalList in CurrentItemInOriginalList:
TemporaryListItem.append(CurrentIndexInCurrentItemInOriginalList)
OtherListOfPermutations.append(''.join(TemporaryListItem))
#Get all of the possible strings into the OtherListOfPermutations List.
# Use Generators, and itertools. It's more efficient and more pythonic
for OriginalString in listOfPermutations:
for CurrentPermutationInCurrentString in FindAllSubsetsOfAString(OriginalString):
OtherListOfPermutations.append(''.join(list(CurrentPermutationInCurrentString)))
#Sort the list
ListOfStringsSortedByLength = OtherListOfPermutations
while not all(len(ListOfStringsSortedByLength[i]) <= len(ListOfStringsSortedByLength[i+1]) for i in xrange(len(ListOfStringsSortedByLength)-1)):
shuffle(ListOfStringsSortedByLength)
#Remove all of the duplicates in the sorted list
ListOfStringsSortedByLengthWithoutDuplicates = []
for CurrentStringWorkingWith in OtherListOfPermutations:
HaveFoundStringInList = False
for CurrentTemporaryString in OtherListOfPermutations:
if CurrentStringWorkingWith == CurrentTemporaryString:
HaveFoundStringInList = True
if(HaveFoundStringInList == True):
ListOfStringsSortedByLengthWithoutDuplicates.append(CurrentStringWorkingWith)
#Use the ListOfStringsSortedByLengthWithoutDuplicates and check if any of the strings are palindromes
ListOfPotentialPalindromes = []
for TemporaryStringToUseForPalindromes in ListOfStringsSortedByLengthWithoutDuplicates:
lengthOfStringToCheck = 0
for currentCharacterInString in TemporaryStringToUseForPalindromes:
lengthOfStringToCheck = lengthOfStringToCheck + 1
if lengthOfStringToCheck != 0:
TemporaryStringToUseForPalindromesReversed = TemporaryStringToUseForPalindromes[::-1]
if TemporaryStringToUseForPalindromesReversed == TemporaryStringToUseForPalindromes:
ListOfPotentialPalindromes.append(TemporaryStringToUseForPalindromes)
#Remove any duplicates that might have snuck in there
ListOfPotentialPalindromesWithoutDuplicates = []
for CurrentPotentialPalindrome in ListOfPotentialPalindromes:
HaveFoundStringInList = False
for CurrentTemporaryPalindrome in ListOfPotentialPalindromes:
if CurrentPotentialPalindrome == CurrentTemporaryPalindrome:
HaveFoundStringInList = True
if(HaveFoundStringInList == True):
ListOfPotentialPalindromesWithoutDuplicates.append(CurrentStringWorkingWith)
lengthOfPalindromes = []
for CurrentPossiblePalindrome in ListOfPotentialPalindromesWithoutDuplicates:
CurrentPossiblePalindromeLength = 0
for currentCharacterInPossiblePalindrome in CurrentPossiblePalindrome:
CurrentPossiblePalindromeLength = CurrentPossiblePalindromeLength + 1
lengthOfPalindromes.append(CurrentPossiblePalindromeLength)
while not all(lengthOfPalindromes[i] <= lengthOfPalindromes[i+1] for i in xrange(len(lengthOfPalindromes)-1)):
shuffle(lengthOfPalindromes)
#find the last value in the list:
currentValue = 0
for currentPalindromeLength in lengthOfPalindromes:
currentValue = currentPalindromeLength
print currentValue
Not really suitable for strings longer than 4 characters. Does "abba" fine, but I went and bought coffee and cooked lunch before it did abcba
Insane variable naming (and inconsistent too)
Ludicrous algorithm choice ( Calculate all possible permutations of every substring of the given string, check if they're palindromes, sort them by length and lookup last value)
Actually contains the solution to the problem
TemporaryStringToUseForPalindromesReversed = TemporaryStringToUseForPalindromes[::-1]
Stupid sorting algorithm (bogosort) and a nutjob method of ensuring the list is sorted.
Also, there's an indentation error in the duplicate checking which actually does nothing at all, it's just a waste of time.
4
C
Finding palindromes is an PNP* hard operation, so it must be done with highly optimized code. Here are five optimization tricks which will help find the solution faster.
if this else that form. (As you go further in your career, you should master Branch Prediction if you want to be a true code ninja.) This code avoids the if branching problem by using for statements instead, which gives you 3 instructions for the price of one.But don't skimp on variable names, readability is important.
* Palindrome-Not Palindrome
#define OFFSET 0XFF
#define ln(s) strlen(s) //macro to avoid runtime overhead
char* boyermore(char* needle, char* haystack){
int i,k[OFFSET];
for(i=0;i<OFFSET;i++)k[i]=ln(haystack);
for(i=1;i<ln(haystack);i++)k[haystack[i]]=ln(haystack)-i;
for(i=2;ln(needle)>=ln(haystack);needle+=k[needle[ln(haystack)]])
for(i=ln(haystack)-1;needle[i]==haystack[i];i--)if(!i)return needle;
return 0xFF-OFFSET;
}
char* reverse(char*src,char*dest,int loops){
for(*(src+loops)=0;loops;src[--loops]=*(dest++));
return src;
}
#define imax(a,b) ((a>b)?a:(b))
int main(int i, char*in[2]){
char* is,*begin,*maybe,max=-1;
char* end=in[-max],*start=end+ln(end);
for(begin=malloc(start-end);--start>end;)
for(i=start-end;i>0;i--)
for(maybe=reverse(begin,start-i,i);boyermore(in[1],maybe);*maybe=1)
for(;i>max;max=imax(i,max))is=start-i;
for(maybe="found";max>0;max=-max) puts(reverse(begin,is,max));
}
Besides the obvious trolling in the commentary, there are several other issues. The search algorithim is a valid implementation of Boyer-Moore-Horspool, but it never stores the string lengths, instead calling strlen something like N*M times, making it much slower than a simple search. "Searching for the longest string first" is true, but after that it does not search by length order, so an early exit would give a wrong answer, if it was implemented. But is is not, so it searches all the N! possibilities anyway. And almost all the parameter names (needle/haystack; src/dest) are reversed from their standard meanings.
3
This is what I have so far in VB6:
Public Function strLongestPalindrome(ByVal strInput as String) as String
strLongestPalindrome = ""
Dim a as Integer
Dim b as Integer
For a = 1 To Len(strInput)
For b = 1 to a
Dim c as Integer
Dim d as Integer
c = a
d = b
Do
If Mid$(strInput, c, 1) = Mid$(strInput, d, 1) Then
c = c + 1
d = d - 1
If c >= d Then
strPalindrome = Mid$(strInput, a, b-a+1)
If Len(strLongestPalindrome) < Len(strPalindrome) Then
strLongestPalindrome = strPalindrome
End If
Exit Do
End If
Else
Exit Do
End If
Loop
Next
Next
End Function
But I don't think it works, and I think I can make it better.
2This is supposed to a last-place, non-trolling answer, although to people who've never coded in VB6 before, you might not know it wasn't supposed to troll. – Joe Z. – 2013-12-28T01:56:24.563
3
Here's a Java solution for you:
public String findLongestPalindrome(String s){
if(s.equals("the longest palindrome")){
return "the longest palindrome";
}else{
throw new IllegalArgumentException();
}
}
3But "the longest palindrome" isn't even a palindrome... – Joe Z. – 2013-12-28T02:02:50.580
2
;msgbox % longest_palindrome_in_string("racecar abcdedcba alkdf")
longest_palindrome_in_string(str){
l := Strlen(str) , max := 1
loop % l
{
p := A_index
loop % l-p
{
s := Substr(str, p, A_index+1) , k := ""
loop, parse, s
k := A_LoopField k
if k = %s%
if (sl:=Strlen(s)) > max
out := s , max := sl
}
}
return out
}
The function returns spaces too as they are part of a palindrome sequence in string. So the above returns <space>abcdedcba<space>.
1
This is trolling because it asks to "find the longest palindrome in a string", so it is finding the longest palindrome in "a string"
String palindrome(){
return null; //There are no palindromes in "a string"
}
This won't return anything when I put "abcba" into it... are you sure it works? – Joe Z. – 2013-12-28T03:28:26.113
@JoeZ. I forgot to say why it was trolling – scrblnrd3 – 2013-12-28T03:30:35.453
5I understand that, but as I've told a bunch of other people, it's too obvious. This kind of wordplay won't make for a good troll. – Joe Z. – 2013-12-28T03:31:27.240
1There are several palindromes (one character long) in “a string.” The code above is incorrect. – Ben – 2013-12-28T15:08:51.577
2@Ben There are 9 palindromes in "a string" - "", "a", " ", "s", "t", "r", "i", "n", "g". The question clearly requests the longest (as in singular) palindrome. Since as I see it, there is a 8 way tie, the answer is undefined. Thus null is an appropriate return value. – emory – 2013-12-28T16:39:08.907
@emory and, depending on your string implementation, \0 – wchargin – 2013-12-28T19:04:01.127
@WChargin \0 is not part of the string, it is, as you alluded, part of the implementation, and therefore should not be considered in the instance you are suggesting. However, depending on how you treat your character data, you could have a string containing a \0, something I had a lot of "fun" dealing with when integrating crypto code between C and Python. – Endophage – 2013-12-30T23:21:41.487
1
I never knew strings could contain palindromes, can you show me where you learned this? And if you need the longest palindrome, please visit this site: http://www.norvig.com/pal2txt.html
1
Iterate through each character of the string. Then check the characters before and after that character. Then the characters two before and two after that character. Keep repeating until you get to characters that are not the same. This will allow you to identify the length of each palindrome in the word. However this method will only work for palindromes of odd length. To check for palindromes of even length, check the character at position i and i-1, then i+1 and i-2, then i+2 and i-3, etc. Hope this helps!!
1
The obvious answer is to compare the string with its own inverse and compute the longest common sequence.
The following Perl program does just that. You may need to download the Acme::DonMartin module, it is not usually installed by default.
use Acme::DonMartin;
sklush klikrunk skroik hee doodle shompah sproingdoink varoom hushle
fwiskitty twop pok zich frack gleep shloop zgluk zlitz faroolana deebe
fump kachoo zock fween boong pitooie oggock gahoff glip fwask padap fut
ooga chukkunk shkaloink kazash splosh sklizzorch fak ahh doom twop
beedoop gak wee fitzrower shkwitz shklik fweep spla gring glink splurp
thomp fwoof thoom kipf ging krunch blib ga kikatik bash dap thork huff
katoonk fak shik stoof dimpah skapasch skronch kachunka arargh sprat
gonk yip inkle blink fagwoosh fowm splapple blamp doomp ploom gishklork
shwik fomp plortch skroik gashplutzga plortch da goyng shtork borfft
zwot ping puffa trump thlip dig blonk thhhut splatch doonk sklizzorch
sprazot pwof slapth spashle kreek eck kik dit foing glukkle glikity
spazoosh plapf gashklitz mabbit boong sklortch swipadda sknikle phelop
skloshitty zat dokka splazitch tika zikka fling shooka glangadang
brrrapp fwizz gasploosh doop swish dikka splesh shooka blut galink
yeech caw tink sklitch shash tffp skrink poffisss oont spazoosh blort
aarh ting ho shpikkle shompah tood shkalink gloople skloshitty
You can find the module here: https://metacpan.org/pod/Acme::DonMartin
– dland – 2013-12-30T20:12:09.2571
Python one-liner:
s = "here goes your string"
print max(p for p in [s.lower()[j:i] for i in range(len(s) + 1) for j in range(len(s) + 1) if ' ' not in s[j:i] and s[j:i] != '' and len(s[j:i]) > 2] if p == p[::-1])
1
Lua is a very fast language (which you need, because there are a lot of substrings to be checked!), but Python is better with string handling. So why not use both?
Because I've heard it's good to have local variables, I have one. Also, I've separated the function calls from their arguments, because too many arguments make expressions cluttered and unreadable.
Also, I think this will work with any strings you want to try, there probably will not be any problems with strange inputs whatsoever.
function is_palindrome()
if os.execute("python -c 'exit(\"" .. is_palindrome_argument .. "\"==\"" .. is_palindrome_argument .. "\"[::-1])'") == true then
return false
else
return true
end
end
function longest_palindrome()
local longest -- very important to use local variables
for length = 1, #longest_palindrome_argument do
for start_index = 1, #longest_palindrome_argument - length + 1 do
is_palindrome_argument = string.sub(longest_palindrome_argument, start_index, start_index + length - 1)
if is_palindrome() then
longest = is_palindrome_argument
end
end
end
return longest
end
longest_palindrome_argument = "foo racecar"
print(longest_palindrome())
(BTW, you won't believe how long this took me to make it work.)
1
Here's my go at this:
k=[]
for i in range(len(p)):
for j in range(i,len(p)):
if p[i:j]==p[j:i:-1]:
k.append(p[i:j+1])
k.sort(key=len)
k=k[-1]
This works in both Python 2.x and 3.x, I believe. The variable k holds the answer.
EDIT: I forgot to say, the variable p should hold the string to check for palindromes.
This is a legit implementation, so it'll work for any string.
Btw, this is my first code golf! Woohoo! :P – cjfaure – 2014-01-06T09:51:19.147
This actually has a code-trolling tag and is thus a code-trolling contest. – Pierre Arlaud – 2014-01-07T10:39:05.040
1@ArlaudPierre Yup, realized that after I posted. Sigh. xD – cjfaure – 2014-01-07T10:44:29.827
I meant thus is a popularity* contest. Okay never mind xD – Pierre Arlaud – 2014-01-07T10:53:02.460
0
Java
Obviously if aString is itself a palindrome then aString is the longest palindrome inside aString. You can tell it is working by the assertion statement. Do not think too much about the first line of executable code. That is just standard java boilerplate.
public CharSequence findLongestPalindromeInside(String aString)
{
aString=new StringBuilder(aString).append(new StringBuilder(aString).reverse());
assert isPalindrome(aString);
return aString;
}
public boolean isPalindrome(CharSequence charSequence)
{
return charSequence.toString().equals(new StringBuilder(charSequence).reverse().toString());
}
0
var str,length,i,out,char;
str=argument0
out=""
length=string_length(argument0)
for(i=0;i<string_length(argument0);i+=1){
char=string_char_at(str,length-i)
out+=char
}
return argument0+out;
Might want to describe what's going on? – Joe Z. – 2013-12-28T18:25:34.327
0
Strings are too tough to work with in Fortran, so I opted to use iachar to convert them all to integers:
program long_palindrome
implicit none
character(len=100) :: string
integer, dimension(100) :: fwd,rev
integer :: i,j,fs,fe,rs,re
print *,"enter string with palindrome hidden in it (max 100 characters)"
read(*,*) string
fwd = 0
! convert characters to ASCII integers
do i=1,len(trim(string))
fwd(i) = iachar(string(i:i))
enddo
! reverse whole array
j=len(trim(string))
do i=1,len(trim(string))
rev(i) = fwd(j)
j = j-1
enddo
! match strings of fwd and rev
rs = 1; re = len(trim(string))
fs = 1; fe = len(trim(string))
! test to see if whole thing is a palindrome
if(all(fwd(fs:fe)==rev(rs:re))) then
print *,"longest palindrome is "//string(fs:fe)//" with length",fe-fs+1
stop
endif
! nope? oh well, guess we have to loop through and find it
fs = 0
do
fs = fs+ 1
do fe = len(trim(string)),fs+1,-1
do rs=1,fs
re = fe-rs+1
if(all(fwd(fs:fe)==rev(rs:re))) then
print *,"longest palindrome is "//string(fs:fe)//" with length",fe-fs+1
stop
endif
enddo
enddo
if(fs==len(trim(string))-1) exit
enddo
print *,"hmm, doesn't look like there was a palindrome of length > 1..."
end program long_palindrome
It doesn't exactly work. Given the string aabbaac it says the longest is aa, but given the string acasdabbbaabb, it says the longest is abbba. Close enough.
Actually, bbaabb is longer in the second one. – Joe Z. – 2013-12-28T16:33:42.317
@JoeZ.: Like I said, close enough. :D – Kyle Kanos – 2013-12-28T16:38:16.113
0
You can't compete in today's market by just doing what is asked. This code will also find the shortest palindrome and is case insensitive:
def flp(s):
lp = 'the longest palindrome'
sp = 'the shortest palindrome'
return lp if lp in s.lower() else sp if sp in s.lower() else ''
>>> flp('xxxxthe longest palindromexxxx')
'the longest palindrome'
>>> flp('xxxxthe shortest palindromexxxx')
'the shortest palindrome'
0
Lua
function findPalendromes(str)
str=str.." "
ret_s=""
for s in str:gmatch"(%w+)[ ]" do
if s==s:reverse() and s:len()>ret_s:len() then ret_s=s end
end
return ret_s
end
0
Most efficient Python implementation that trumps all other efforts:
def find_the_longest_palindrome(s):
print "'the longest palindrome' found at : " + str(s.find("the longest palindrome"))
Notes:
This will always find "the longest palindrome"
It is case sensitive.
With some modifications it can also be made to find other strings. However, you will need to create a class, add an appropriate method and then subclass it for each string to be found.
This function could be improved by porting to FORTRAN 77 or hard-coding into Intel 8008 machine code.
0
This is my first code trolling answer. It isn't a particularly brutal troll, it just struck me as a silly way to answer the question
private static String findLongestPalindrome(String input) {
String longest = null;
for (int i = 1; i <= input.length(); i++) {
Matcher m = pattern(i).matcher(input);
if (m.find()) {
longest = m.group();
}
}
return longest;
}
private static Pattern pattern(int len) {
int size = len / 2;
StringBuilder sb = new StringBuilder();
for (int i = 0; i < size; i++) {
sb.append("(.)");
}
if (len != size * 2) {
sb.append(".");
}
for (int i = size; i > 0; i--) {
sb.append("\\").append(i);
}
return Pattern.compile(sb.toString());
}
Trolls are:
0
from itertools import takewhile
def common_part(s1, s2):
return sum(takewhile(bool, (a==b for a, b in zip(s1, s2))))
def palindromes(s):
for i in range(1, 2*len(s)):
m = i//2; n = i - m
common = common_part(s[n-1::-1], s[m:])
p = s[n-common:m+common]
if p: yield p
string = input('> ')
print('Longest palindrome is', repr(max(palindromes(string), key=len)))
Very efficient program. It searches long palindroms with center in sequential positions (on char and between) and select longest
7If you couldn't tell, this is another trolling problem, although with less explanation than the last. – Joe Z. – 2013-12-28T01:52:01.197
19Sadly, "a string" doesn't have any palindromes in it at all. – Mark Reed – 2013-12-28T03:16:44.343
You're forgetting one-character palindromes. – Joe Z. – 2013-12-28T03:17:17.810
17So
code-trollingis my new favorite tag. – None – 2013-12-28T03:47:01.3771And it only has two questions! – Joe Z. – 2013-12-28T04:00:50.730
2
Actually 3. I'm very proud of my answer on the 3rd one: http://codegolf.stackexchange.com/questions/16344/generate-random-sequence-of-numbers
– None – 2013-12-28T04:04:27.2004We've got two code-trolling questions on the Hot Network Questions list now! – Joe Z. – 2013-12-28T04:58:55.630
1Make that 4 questions. – None – 2013-12-28T05:05:55.163
2Why didn't you verb? – hippietrail – 2013-12-28T08:24:41.893
18Hmmm. While the first [code-trolling] question was amusing, I cannot help but feel that these questions will really decrease the quality of this site if you guys are not careful. These questions are easy to make and easy to answer poorly, and I can see these getting old very, very fast. Just my 2 cents. – Reid – 2013-12-28T11:20:29.450
1@JoeZ Don't forget zero character palindromes. – emory – 2013-12-28T14:15:09.230
2
@Reid Very true. The initial question also attracted a lot of too-obvious, zero-effort answers. We're currently discussing the standards of code-trolling answers in the meta. I personally think that about 30% of the answers even to this question aren't acceptable (including grc's "racecar" solution), although people are starting to make the effort to create more meaningful answers.
– Joe Z. – 2013-12-28T16:04:18.027@hippietrail: It's a "How do I <noun>" meme. – Joe Z. – 2013-12-28T16:05:05.470
@MarkReed "a string" does have many palindromes in it, namely "a", " ", "s", "t", "r", "i", "n", "g" and "". – rightfold – 2013-12-28T18:57:42.600
So, did you now edit the question for no other purpose than to bring it back up to the front page? How trolling! Sorry, but now I have no choice but to upvote. – Mr Lister – 2013-12-29T16:52:52.460
What? No, I just thought the title was bad. I didn't even remember that editing questions bumped them up. – Joe Z. – 2013-12-29T17:59:52.123
1I actually think this would be a good code golf question. – Cruncher – 2014-01-06T15:06:34.363
You can make the code-golf version, if you want to. – Joe Z. – 2014-01-06T15:35:35.703
Code-trolling is in the process of being removed, as per the official stance. This question is very highly voted with many answers, many of which are highly voted. It recieved just slightly over 50% "delete" votes on the poll, but it is unique in that it recieved so many answers and votes, so I am locking it for historical significance.
– Doorknob – 2014-05-12T00:04:21.727